Since my protein failed I had to do a phosphatase enzyme test on YopH. This showed pretty good results since there is an increase then a slight plateau towards the end.
It seems that my protein completely failed because it did not even show up on the FPLC graph. It is suppose to appear between the two peaks in the dashed blue line because it has a molecular weight of 35 kDa.
My graph is showing a pretty good curve with a concentration of 1.17 mg/ml. This should work in the FPLC.
WEEK 13
No results this week, still working on virtual screening on compounds to see my top ligands match the compound being tested
in wet lab.
WEEK 12
Jericho - I think this looks ok. Not sure which is your Elution one lane, but you shoudl thinkg about going to FPLC to further purify. - Dr. B
The band in Elution 1 that seems like my protein is between 35 kda and 25 kda. The MW of my protein is around 35800. I may have failed my gel.
Lane 1 Protein Ladder, Lane 2 Sample 5, Lane 3 Sample 6, Lane 4 Sample 1, Lane 5 Sample 2, Lane 6 Sample 3, Lane 7 Sample 4
The MW of my protein is around 35800 and it seems by looking at Elution 1 that there is a band around that area. Elution 2 is almost invisible because it is not suppose to have much protein.
Sample's 2 and 3 are all over the place because it is the soluble fraction and flow through,it has everything.
I chose DNA instead of Protein Nanodrop last week, so this week I uploaded the Protein Results.
Elution 1 has a higher concentration than Elution 2. This is how it is suppose to be because elution 1 has more protein than elution 2
WEEK 11 - Jericho - do these Nanodrops using the Protein setting, not the DNA setting! - Dr. B
Protein Characterization is the next step.
These are the concentrations I received for Elution 1 and 2.
Most of the protein was released after the first 5 ml of Elution Buffer. This may account for the high concentration.
This may have a lower concentration because most of the protein was released after the first elution, this second elution released the remaining protein.
WEEK 10
I am currently working on protein expression.
This are the top ten ligands for cb_306 and HF9. Since my target is PP2Ctg it has calciums in it's active site. I only left 6 waters that had a polar contact with the calciums when I screened both libraries. These have high scores since they are all over 120.
WEEK 9
I have to continue running more libraries against my target in order to find top ligand.
I will have to run my run with calcium's again, because I will add the waters that have a polar contact with the calcium ions.
This is the top ten ligands for my two runs. I made 1 run of my target with it's calcium ions and another run with no calcium's. An important note is that they both have the same top ligand.
WEEK 8
I am still working on the virtual screening of my target.
I got a really good concentration for my secondary PCR after PCR2 and the cleanup process.
LANE 2 100BP ladder, Lane 3 secondary PCR
To make the secondary PCR I used a ul of the first primary PCR and then I just made a gel out of 100bp and the secondary PCR. I got a really strong band.
WEEK 7
I am currently working on my virtual screening of my target.
Lane 2 100bp Ladder, Lane 3 sprimary PCR, Lane 4 secondary PCR
This is my 2nd Trial of Primer Overlap, and it failed since my secondary PCR did not work and it even seems that my primary PCR has a small smear.
This is my second nanodrop using the other 100 ul of PCR squared and I got a lower concentration.
This is my first nanodrop using 100 ul of the 200 ul of PCR squared. It gave me a really low concentration. A good concentration should be 300 ng/ul.
WEEK 6
- good, -- Dr. B
PCR Primer Overlap VDS
Lane 1 and 2 are 100 bp ladders, Lane 2 is the primary PCR, Lane 3 is the secondary PCR.
The length of my gene or interest is 996 nucleotides long. The ladder shows that the stain is within that region (1000).
I believe my secondary PCR was successful because it has 1 stain in the 1000 region. The primary PCR shows a smear as well.
WEEK 5
I finished 3 protocols this week, they were PCR Primer Design for pNIC-Bsa4 Cloning, PCR Primer Design for Primer Overlap Assembly PCR, Virtual Screen Refresher.
PCR Primer Design for Primer Overlap Assembly PCR
FINAL SUMMARY FOR 1 SOLUTION
Tm - 62
Len - 60
Score - 0.000
TmRange - 2.0
Short - 16
Long - 60
#Olig - 24
#Repeat - 0
#Misprime - 0
Lane 1 skipped, Lane 2 100bp ladder, Lane 3 low concentration, Lane 4 medium concentration, Lane 5 high concentration
My experiment went better than last time for pLIC sequencing vectors of pNIC-Bsa4. In this case the highest concentration had the stain, but none of the others had any stain.
WEEK 3
I also worked on my PyMOL Refresher this week.
1st Trial of Protocol PCR Sequencing of pLIC
Lane 1 skipped, Lane 2 100 bp ladder, Lane 3 lowest conc, Lane 4 medium conc., Lane 5 highest conc., Lane 6 control
This is the image for PCR protocol for pLIC sequencing vectors of pNIC-Bsa4. I failed it probably because of wrong dilutions.
WEEK 2
2nd Trial of PCR of pGBR22
9-9-11 PCR and RE Digest Lane 1 skipped, Lane 2 100 bp ladder, Lane 3 Sample A of PCR, Lane 4 Sample B of PCR, Lane 5 Sample C of PCR, Lane 6 Sample D of PCR no Dna, Lane 7 1 kb Ladder, Lane 8 Uncut pGBR22, Lane 9 EcoR1, Lane 10 Pvu11, Lane 11 EcoR1 and Pvu11
Lane 9 has EcoR1 so there should be 1 band because EcoR1 only cuts once while in Lane 10, which is Pvu11, there should be 2 bands because Pvu11 cuts twice.
This is the Submit to DNA Sequencing
This is the Forward Sequence for the pGBR22 using nucleotide collection as the database.
This is the Reverse Sequence for the pGBR22 using nucleotide collection as the database.
Forward Sequence
Using nucleotide blast, Human G+T, and the somewhat similar sequences option the Forward sequence for the pGBR22 I submitted was attempted to be found. It seems my sequence had a low alignment score for almost everything.
Reverse Sequence
Using the same options as the Forward sequence the pGBR22 sequence I submitted gave this. It seems it also has a low alignment score for almost everything since it has poor alignment for 80 percent for the nucleotides.
WEEK 1
This is the PCR of pGBR22
1st Trial of PCR
Lane 1 skipped, Lane 2 100bp ladder, Lane 3 Tube A of pGBR22 PCR, Lane 4 skipped, Lane 5 skipped, Lane 6 Tube B of pGBR22 PCR, Lane 7 Tube C of pGBR22 PCR, Lane 8 Tube D of pGBR22 PCR
My experiment failed, since the DNA did not appear on any lanes besides the 100bp ladder and lane 7 where you can see two faint stains. The mistake may have been when I was diluting the templates and the Taq DNA Polymerase NEB.
WEEK 14
Since my protein failed I had to do a phosphatase enzyme test on YopH. This showed pretty good results since there is an increase then a slight plateau towards the end.
It seems that my protein completely failed because it did not even show up on the FPLC graph. It is suppose to appear between the two peaks in the dashed blue line because it has a molecular weight of 35 kDa.
My graph is showing a pretty good curve with a concentration of 1.17 mg/ml. This should work in the FPLC.WEEK 13
No results this week, still working on virtual screening on compounds to see my top ligands match the compound being tested
in wet lab.
WEEK 12
Jericho - I think this looks ok. Not sure which is your Elution one lane, but you shoudl thinkg about going to FPLC to further purify. - Dr. BThe band in Elution 1 that seems like my protein is between 35 kda and 25 kda. The MW of my protein is around 35800. I may have failed my gel.
The MW of my protein is around 35800 and it seems by looking at Elution 1 that there is a band around that area. Elution 2 is almost invisible because it is not suppose to have much protein.
Sample's 2 and 3 are all over the place because it is the soluble fraction and flow through,it has everything.
I chose DNA instead of Protein Nanodrop last week, so this week I uploaded the Protein Results.
Elution 1 has a higher concentration than Elution 2. This is how it is suppose to be because elution 1 has more protein than elution 2
WEEK 11 - Jericho - do these Nanodrops using the Protein setting, not the DNA setting! - Dr. B
Protein Characterization is the next step.
These are the concentrations I received for Elution 1 and 2.
Most of the protein was released after the first 5 ml of Elution Buffer. This may account for the high concentration.
This may have a lower concentration because most of the protein was released after the first elution, this second elution released the remaining protein.
WEEK 10
I am currently working on protein expression.
This are the top ten ligands for cb_306 and HF9. Since my target is PP2Ctg it has calciums in it's active site. I only left 6 waters that had a polar contact with the calciums when I screened both libraries. These have high scores since they are all over 120.
WEEK 9
I have to continue running more libraries against my target in order to find top ligand.
I will have to run my run with calcium's again, because I will add the waters that have a polar contact with the calcium ions.
This is the top ten ligands for my two runs. I made 1 run of my target with it's calcium ions and another run with no calcium's. An important note is that they both have the same top ligand.
WEEK 8
I am still working on the virtual screening of my target.
I got a really good concentration for my secondary PCR after PCR2 and the cleanup process.
To make the secondary PCR I used a ul of the first primary PCR and then I just made a gel out of 100bp and the secondary PCR. I got a really strong band.
WEEK 7
I am currently working on my virtual screening of my target.
This is my 2nd Trial of Primer Overlap, and it failed since my secondary PCR did not work and it even seems that my primary PCR has a small smear.
This is my second nanodrop using the other 100 ul of PCR squared and I got a lower concentration.
This is my first nanodrop using 100 ul of the 200 ul of PCR squared. It gave me a really low concentration. A good concentration should be 300 ng/ul.
WEEK 6
- good, -- Dr. BPCR Primer Overlap VDS
The length of my gene or interest is 996 nucleotides long. The ladder shows that the stain is within that region (1000).
I believe my secondary PCR was successful because it has 1 stain in the 1000 region. The primary PCR shows a smear as well.
WEEK 5
I finished 3 protocols this week, they were PCR Primer Design for pNIC-Bsa4 Cloning, PCR Primer Design for Primer Overlap Assembly PCR, Virtual Screen Refresher.
PCR Primer Design for Primer Overlap Assembly PCR
FINAL SUMMARY FOR 1 SOLUTION
Tm - 62
Len - 60
Score - 0.000
TmRange - 2.0
Short - 16
Long - 60
#Olig - 24
#Repeat - 0
#Misprime - 0
PCR Primer Design for pNIC-Bsa4 Cloning
Upstream:
5’ TACTTCCAATCCATGATGGATGTACCACCTACCATT 3’
Downstream:
5’ TTCTTCAAAAAAACCGACTAACAGTAAAGGTGGATA 3’
Reverse Complement:
5’ TATCCACCTTTACTGTTAGTCGGTTTTTTTGAAGAA 3’
Accepting Vector with Insert
....GGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATC
CATGGATGTACCACCTACCATTCACGTTCCTCTGCCGCCGACGTCTTACCCGGCGTTCGACGCGGCGATCTTCACCA
CATCGGTGGCCGTAAACA....GCGCCGACAACACCGCGATGACGGTTTTCTTCAAAAAAACCGACTAACAGTAAAGGTGGATA.....
The blue font is the 6 His Tag. The Purple font is the Forward and Reverse Primers, while the teal font is
the start and stop codon.
Image of Accepting Vector
Virtual Screen Refresher
Top Ten Ligands
WEEK 4
2nd Trial of Protocol PCR Sequencing of pLIC
My experiment went better than last time for pLIC sequencing vectors of pNIC-Bsa4. In this case the highest concentration had the stain, but none of the others had any stain.
WEEK 3
I also worked on my PyMOL Refresher this week.
1st Trial of Protocol PCR Sequencing of pLIC
This is the image for PCR protocol for pLIC sequencing vectors of pNIC-Bsa4. I failed it probably because of wrong dilutions.
WEEK 2
2nd Trial of PCR of pGBR22
Lane 9 has EcoR1 so there should be 1 band because EcoR1 only cuts once while in Lane 10, which is Pvu11, there should be 2 bands because Pvu11 cuts twice.
This is the Submit to DNA Sequencing
This is the Forward Sequence for the pGBR22 using nucleotide collection as the database.
This is the Reverse Sequence for the pGBR22 using nucleotide collection as the database.
Using nucleotide blast, Human G+T, and the somewhat similar sequences option the Forward sequence for the pGBR22 I submitted was attempted to be found. It seems my sequence had a low alignment score for almost everything.
Using the same options as the Forward sequence the pGBR22 sequence I submitted gave this. It seems it also has a low alignment score for almost everything since it has poor alignment for 80 percent for the nucleotides.
WEEK 1
This is the PCR of pGBR22
1st Trial of PCR
My experiment failed, since the DNA did not appear on any lanes besides the 100bp ladder and lane 7 where you can see two faint stains. The mistake may have been when I was diluting the templates and the Taq DNA Polymerase NEB.